New & Noteworthy
Changes to Saccharomyces cerevisiae GFF3 file
March 01, 2024
The saccharomyces_cerevisiae.gff contains sequence features of Saccharomyces cerevisiae and related information such as Locus descriptions and GO annotations. It is fully compatible with Generic Feature Format Version 3. It is updated weekly.
After November 2020, SGD updated the transcripts in the GFF file to reflect the experimentally determined transcripts (Pelechano et al. 2013, Ng et al. 2020), when possible. The longest transcripts were determined for two different growth media – galactose and dextrose. When available, experimentally determined transcripts for one or both conditions were added for a gene. When this data was absent, transcripts matching the start and stop coordinates of an open reading frame (ORF) were used.
Beginning in February 2024, SGD increased the start and stop coordinates of genes to encompass the start and stop coordinates of the longest experimentally determined transcripts, regardless of condition. This change was made in order to comply with JBrowse 2, a newer and more extensible genome browser, which requires that parent features in GFF files (genes) are larger than child features (mRNA, CDS, etc) (Diesh et al., 2023).
This is a standard format used by many groups. SGD uses the GFF file to load the reference tracks in SGD’s genome browser resource.
Categories: Announcements, Data updates
Tags: biology, blog, genetics, news, Saccharomyces cerevisiae
Fpt1p is a negative regulator of RNA Polymerase III embedded in the tDNA chromatin-proteome
November 27, 2023
Gene transcription is facilitated by RNA polymerase enzyme complexes that collaborate with transcription factors, repressors, chromatin remodelers, and other cellular factors. RNA Polymerase III (RNAPIII) mainly transcribes short DNA fragments called tDNAs, that code for transfer-RNAs (tRNAs). In repressive conditions, tDNA transcription is repressed by the well-characterized protein Maf1. A new study by Van Breugel et al., recently published in Molecular Cell, identified Fpt1p (YKR011C) as an additional regulator of RNAPIII in S. cerevisiae.
By using Epi-Decoder, a technique based on synthetic genetic array (SGA), chromatin immunoprecipitation and DNA-barcode sequencing, the local chromatin-proteome of a single tDNA was decoded in active and repressive conditions. The authors found major reprogramming of the core RNAPIII transcription machinery and other known chromatin-binding proteins. Surprisingly, they found the protein Ykr011c to be enriched in the tDNA chromatin-proteome, especially under repressive conditions, prompting the authors to rename the gene FPT1 (Factor in the Proteome of tDNAs number 1).
Following up on the Epi-Decoder finding, genome-wide sequencing methods such as ChIP-seq and ChIP-exo revealed that Fpt1p uniquely binds RNAPIII-regulated genes. Using the anchor away system to conditionally deplete core RNAPIII transcription factors from the nucleus, Fpt1 binding to tRNA genes was found to require both TFIIIB and TFIIIC but not RNAPIII or ongoing transcription. tRNA genes have been described to differentially respond to repressive signals but gene-specific regulatory mechanisms have largely remained elusive. Looking at Fpt1p, Van Breugel et al. found a correlation between tDNA responsiveness to repressive signals and Fpt1p occupancy, suggesting a negative regulatory role for Fpt1p. Substantiating these results, FPT1 knockout strains showed increased occupancy of RNAPIII and TFIIIB at tRNA genes, while TFIIIC occupancy decreased. These outcomes point towards a role for Fpt1p in promoting eviction of RNAPIII upon repressive signals.
In summary, taking advantage of multiple yeast genetic approaches, Van Breugel et al. found that the previously uncharacterized protein Fpt1 is a bona fide RNAPIII regulator in S. cerevisiae. Their research emphasizes the importance of not overlooking uncharacterized proteins, as they may possess alternative regulatory roles that could change our views on fundamental cellular processes.
Text and image provided by Marlize van Breugel, MSc.
Categories: News and Views
Tags: RNA polymerase III, Saccharomyces cerevisiae
Reference Genome Annotation Update R64.4
September 08, 2023
The S. cerevisiae strain S288C reference genome annotation was updated. The new genome annotation is release R64.4.1, dated 2023-08-23. Note that the underlying genome sequence itself was not altered in any way.
This annotation update included:
- new uORFs for 3 ORFs:
- 8 new ncRNAs:
- 3 ORFs demoted from ‘Uncharacterized’ to ‘Dubious’ based on request from NCBI because they overlap tRNAs:
R64.4 Annotation update details
| Chr | Feature | Description of change | Reference |
|---|---|---|---|
| III | SUT035/YNCC0015W | New ncRNA chrIII:205766..205942 (+ strand) | Xu Z, et al. (2009) PMID:19169243,Balarezo-Cisneros LN, et al. (2021) PMID:33493158 |
| IV | YDR278C | Change ORF qualifier from Uncharacterized to Dubious | Requested by NCBI |
| IV | SUT053/YNCD0033W | New ncRNA chrIV:506334..507774 (+ strand) | Xu Z, et al. (2009) PMID:19169243,Balarezo-Cisneros LN, et al. (2021) PMID:33493158 |
| IV | SUT468/YNCD0034C | New ncRNA chrIV:506546..507450 (- strand) | Xu Z, et al. (2009) PMID:19169243,Balarezo-Cisneros LN, et al. (2021) PMID:33493158 |
| VII | SUT532/YNCG0047C | New ncRNA chrVII:17213..17709 (- strand) | Xu Z, et al. (2009) PMID:19169243,Balarezo-Cisneros LN, et al. (2021) PMID:33493158 |
| VII | SUT125/YNCG0048W | New ncRNA chrVII:650855..651159 (+ strand) | Xu Z, et al. (2009) PMID:19169243,Balarezo-Cisneros LN, et al. (2021) PMID:33493158, Feng MW, et al. (2022) PMID:36712349 |
| VII | SUT126/YNCG0049W | New ncRNA chrVII:660087..661399 (+ strand) | Xu Z, et al. (2009) PMID:19169243,Balarezo-Cisneros LN, et al. (2021) PMID:33493158 |
| XII | FPS1/YLL043W | New uORF uORF2 3 codons chrXII:49924..49932 (+ strand) ATGCATTAA | Cartwright SP, et al. (2017) PMID:28279185 |
| XIV | ACC1/YNR016C | New uORF 4 codons chrXIV:661704..661715 (- strand) ATGTGTTTATAA | Blank HM, et al. (2017) PMID:28057705 |
| XIV | HOL1/YNR055C | New uORF 7 codons chrXIV:730381..730401 (- strand) ATGCTATTACTACCAAGTTGA | Vindu A, et al. (2021) PMID:34375581 |
| XV | YOL013W-A | Change ORF qualifier from Uncharacterized to Dubious | Requested by NCBI |
| XVI | SUT390/YNCP0025W | New ncRNA chrXVI:52977..53465 (+ strand) | Xu Z, et al. (2009) PMID:19169243, Feng MW, et al. (2022) PMID:36712349 |
| XVI | SUT418/YNCP0026W | New ncRNA chrXVI:588998..589830 (+ strand) | Xu Z, et al. (2009) PMID:19169243, Feng MW, et al. (2022) PMID:36712349 |
| XVI | YPR108W-A | Change ORF qualifier from Uncharacterized to Dubious | Requested by NCBI |
Various sequence and annotation files are available on SGD’s Downloads site.
Categories: Data updates
Tags: genome annotation update, Saccharomyces cerevisiae
Prion-like domain in Ty1 Gag protein
July 18, 2023
Retrovirus-like retrotransposons help shape the genome evolution of their hosts and replicate within cytoplasmic particles. However, how their building blocks associate and assemble within the cell is poorly understood. A new study by Sean Beckwith and coworkers, recently published in PNAS, reports a prion-like domain (PrLD) in the Saccharomyces retrotransposon Ty1 Gag protein.
Gag, also found in retroviruses like HIV, is the structural protein that assembles virus-like particles (VLPs). The PrLD has similar sequence properties to prions and disordered protein domains that can drive the formation of assemblies that range from liquid to solid. The Ty1 PrLD acts like a prion when tested in a cell-based prionogenesis assay, and is essential for transposition (Ty1 doesn’t transpose without it!), but researchers were able to restore transposition by replacing the Ty1 PrLD with similar disordered sequences from yeast SUP35 and mouse PrP prions (how cool is that?!).
These findings from Beckwith et al. uncover a critical function for often overlooked disordered sequences, demonstrate greater flexibility in VLP assembly than previously appreciated, and establish an interchangeable “plug-and-play” platform to study disordered sequences in living cells – all by using the awesome power of yeast genetics (#APOYG!).
— Text from Sean Beckwith, with edits from SGD.
Categories: Research Spotlight
Tags: Saccharomyces cerevisiae, transposon
GENETICS Knowledgebase and Database Resources
May 08, 2023
The May 2023 issue of GENETICS features the second annual collection of Model Organism Database articles. Scientists from Alliance of Genome Resources member groups SGD, RGD, ZFIN, Gene Ontology, and Xenbase have provided updates on recent activities and innovations. Be sure to browse the issue and get acquainted with these excellent Knowledgebase and Database Resource papers at GENETICS. Cover art by Vivid Biology.
Categories: Announcements
Tags: Saccharomyces cerevisiae, yeast
Role of Sumoylation in Regulating Replication
September 09, 2022
There are ~400 origins of replication in yeast, each of which can be “licensed” by the binding of the conserved origin recognition complex (ORC) and then the MCM replicative helicase complex, all of which happens in G1 phase. During the subsequent S phase, origins are then “activated” by binding of several other replication factors, leading to unwinding and then nascent strand synthesis.
The regulation of origin licensing and activation is a complex, multi-level process, for which numerous aspects of the picture remain unclear. As yeast has the most tools for studying this process, including a full map of origins and numerous options for genetic and biochemical modulations, it presents the ideal model in which to ask probing questions. A recent study by Regan-Mochrie et al. in Genes & Development has revealed the key role of sumoylation in regulation of genome replication.
The origin recognition complex comprises six subunits, encoded by ORC1 to ORC6. The authors built on previous results showing sumoylation of these proteins during DNA damage to ask about their modification status under normal growth. They were able to assess sumoylation status for four of the six subunits, observing various degrees of sumoylation of Orc1p, Orc2p, Orc4p, and Orc5p. They then created a construct to hypersumoylate Orc2p to ask how this affects cells, and found it led to cell lethality. This lethal effect was specific to the Orc protein, as other non-Orc hypersumoylated proteins were tolerated.
The lethality could be rescued by reducing the levels of a SUMO-conjugating enzyme, further indicating the specificity of the effect. The authors identified a subset of early origins that were preferentially inhibited upon hypersumoylation and, upon study, determined that the extra sumoylation interfered with loading of the MCM complex.
After identifying the residues becoming sumoylated on Orc2p, the authors were able to generate mutants to ask about the converse, i.e. hyposumoylation. Indeed, as might be hypothesized, lack of sumoylation caused DNA replication defects via abnormal increased firing of early origins.
Thus, by close study in yeast, the role of sumoylation in genomic stability becomes more clear, where sumoylation of ORC subunits affects loading of the MCM complex, which is itself the substrate for loading of activation factors. Modulated sumoylation status appears to provide a key level of regulatory control.
Categories: Research Spotlight
Tags: cell cycle control, DNA replication, ORC complex, origin recognition complex, regulation of replication, Saccharomyces cerevisiae, sumoylation
Humanizing Glycolysis in Yeast
September 02, 2022
While glycolysis is highly conserved between unicellular yeast and multicellular humans, it appears that not only the glycolytic functions but also the secondary (aka “moonlighting”) functions of the relevant proteins remain largely consistent. This consistency presents unique opportunities for better understanding human glycolysis in muscle tissue and elsewhere.
The technical challenges of studying glycolytic enzymes are not trivial—largely due to genetic redundancy for such critical components—but a recent report by Boonekamp et al. in Cell Reports explains how the authors built on previous work to overcome the obstacles in yeast. Employing a minimized set of glycolytic genes that were also relocated to a single chromosome (strain SwYG) made it possible to swap in human orthologs with relative ease.
The authors first looked at direct complementation of yeast genes by 25 human glycolytic enzymes. Remarkably, 22 of 25 human genes readily complemented their yeast counterpart. The three exceptions were hexokinases 1, 2, and 3 (HsHK1, HsHK2, and HsHK3), which are roughly twice the size of their yeast orthologs and have lower sequence conservation.
As glycolysis cannot take place without the hexokinases, the authors first looked more closely at HsHK1 and HsHK2 to ask why they fail to function in yeast. Upon exposure to glucose, for which the native human proteins could not support growth, they created conditions to select for systematic mutations that conferred improved glycolysis. The mutant proteins proved to be less sensitive to inhibition by glucose-6-phosphate (G6P), a potent allosteric inhibitor of hexokinase activity.
With this understanding, the authors set out to complement the entire pathway in yeast with human proteins. They created two different strains, one with HsHK2 because it is considered the main isoenzyme in human muscle (strain HsGly-HK2), and one with HsHK4 because it shows less inhibition by G6P (strain HsGly-HK4). The HsGly-HK2 strain could not grow well on glucose until after a long lag phase in which mutations were selected near the G6P-binding site of HsHK2.
Comparing the uptake and output of the two humanized yeast strains to the native yeast strain revealed a number of intriguing differences, especially around the different enzyme activities between human and yeast. These differences led to different behaviors on different carbon sources and overall slower growth and glycolytic flux for the humanized strains versus native yeast.
Three glycolytic yeast enzymes have secondary “moonlighting” roles beyond their function in glycolysis. Hexokinases are involved in glucose repression of genes such as invertase (SUC2), and, indeed, it appears that human hexokinases can also at least partially complement this secondary function. Yeast aldolase (FBA1) plays a secondary role in vacuolar function that is required for growth at alkaline pH. This function is likewise complemented by the human orthologs, where the humanized strains can grow at pH 7.5. The third moonlighter is enolase, where yeast ENO2 is required for mitochondrial import of tRNALys, thereby allowing growth at higher temperatures and on non-fermentable carbon sources. All three human enolases can at least partially complement this growth defect, and thus appear to have the same secondary function.
Despite the high conservation of functions, the humanized yeast strains have a slow growth phenotype. The authors used this phenotype to employ adaptive laboratory evolution to see which genomic changes restore growth. Interestingly, the mutations that restored growth were mostly not in the glycolytic enzymes themselves, but in associated factors that regulate enzyme abundance and activity. The identity of these regulators and the potential for targeting them in human muscle have already rewarded the successful transfer of skeletal muscle glycolysis into yeast.
Categories: Research Spotlight
Tags: glycolysis, humanizing yeast, muscle glycolysis, Saccharomyces cerevisiae, yeast model for glycolysis
Link Between Aging and Iron
August 25, 2022
Perturbations in iron homeostasis affect aging, but how this happens has remained a bit of a black box. A new study by Patnaik et al. in Cell Reports illuminates this box by looking more closely at the transcription factors that are first to respond when iron becomes limiting.
Key among these are Atf1p and Atf2p, which activate the full suite of iron-mobilization genes, among which is TIS11/CTH2, which encodes an RNA-binding protein that targets specific messages for decay.
The targeted messages flagged for decay encode mitochondrial proteins, as these use iron but are not the most essential in the set. The most essential Fe-requiring enzymes are those involved in DNA synthesis and repair, such that slowing/shutting mitochondrial function is a response to iron deficiency. Intriguingly, mitochondrial function also happens to decline with age.
To find the specific mechanisms linking iron with aging, the authors used an unbiased analysis of genes involved in iron homeostasis to see which showed connection with aging. The strain with a tis11Δ mutation lived longer than any others, with a lifespan extended by 51.1%. In a broader sense, they found that genes involved in different aspects of response to iron deficiency also had different effects on fitness and aging.
Delving more deeply into the role of Tis11p/Cth2p in aging, the authors used RNA-seq and Ribo-seq to look at temporal changes in transcription versus translation in aging cells. They showed how, overall, aging leads to inhibition of translation—except for certain genes which are upregulated instead. Interestingly, most of the upregulated genes are in the Fe regulon that gets activated by the first responder Atf1p.
While the expression of TIS11/CTH2 increases both with aging and with iron deficiency, the deletion of the gene extends lifespan. Thus, multiple lines of evidence suggest Tis11p/Cth2p is a negative regulator of longevity. The key connection appears to be mitochondrial translation, where the function of Tis11p/Cth2p to inhibit translation of mitochondrial transcripts for repressing non-essential Fe-requiring enzymes serves to simultaneously repress overall mitochondrial respiration, which speeds aging.
As not all genes translationally upregulated in the tis11Δ mutant contained appropriate binding sites in the 3’ UTR, the authors looked further and found binding sequences for Puf3p, a protein known to bind and inhibit translation of mRNAs coding for mitochondrial ribosome proteins. Thus, Puf3p appears to be a critical partner for Tis11p/Cth2p in mediating downregulation of mitochondrial function. Further, they questioned the relationship with the Hap4p transcription factor, which regulates numerous components of the electron transport chain and whose overexpression extends lifespan. As the combination of a tis11Δ deletion with HAP4 overexpression had no additive effect in an epistasis experiment, they concluded that Tis11p-dependent repression acts through Hap4p.
The role of phosphorylation of Tis11p/Cth2p was examined by mutating N-terminal serine residues, which impairs degradation of the protein. Consistent with the converse result of extended lifespan in null mutants, the nondegradable version of the protein shortens lifespan.
Thus, the ease of the yeast model once more illuminates intricate connections between critical proteins, facilitating potential drug discovery around several new aging factors.
Categories: Research Spotlight
Tags: aging, cell aging, iron homeostasis, Saccharomyces cerevisiae, yeast model for aging
Sen1p Is the Traffic Cop for RNA Polymerase III
August 12, 2022
One way to imagine DNA is as a busy road with a lot of competing traffic. Say, a small village in southern Italy…where someone must mediate conflicts between competing vehicles to avoid disaster.
It turns out that the “someone” in yeast cells is Sen1p. Two recent papers from associated groups describe the intriguing detail of how the Sen1p helicase plays this role for RNA polymerase III transcription. The paper by Aiello et al. in Molecular Cell shows how Sen1p regulates transcription-driven conflicts between the several machineries all engaged with DNA. In the related paper by Xie et al. in Science Advances, the authors show how the Sen1p helicase mediates “fail-safe” methods of transcription termination for RNA Pol III, thereby promoting efficiency and avoiding conflict with other pieces of machinery.
The key conflict preventing RNA Pol III from transcribing noncoding genes is with RNA Pol II, which is busy transcribing coding genes. Aiello et al. show how Sen1p has two strategies for mediating these conflicts, both of which involve interactions between Sen1p and the replisome. One involves temporary release of RNA Pol II from DNA while the other resolves genotoxic R-loops in nascent RNA. Both are critical for preventing genome instability.
In the related paper by Xie et al., the authors focus on how termination of transcription of noncoding genes by RNA Pol III is achieved, and the role that Sen1p plays in termination. They show how Sen1p can interact with all three polymerases and also with the other two subunits (Nrd1p and Nab3p) of the NRD1 snoRNA termination (NNS) complex. More specifically, they show by mutation and co-immunoprecipitation that it is the N-terminal domain (NTD) of Sen1p that interacts with RNA Pol III and the replisome.
The authors use metagene analysis of RNA Pol II distribution at mRNA-coding genes to show how Sen1p can promote the release of RNA Pol II to resolve transcription-replication conflicts (TRCs). They further show how the association of Sen1p with the replisome is required for limiting TRCs at the ribosomal replication fork barrier, and how this action appears redundant with that of RNases H. The cooperation and redundancy in this role are key means to protect genome stability.
Not only is Sen1p required for termination of RNA Pol III transcription, but the authors show how this function is independent of the NNS complex. Unlike resolution of conflicts between RNA Pol II and RNA Pol III, the termination function of Sen1p does not require the replisome.
They asked the question of whether Sen1p acts via the primary termination site for RNA Pol III or, rather, a backup secondary termination that catches errors (i.e., when RNA Pol III reads through a weak termination site). Termination for RNA Pol III employs a tract of T nucleotides (T-tract) in the nontemplate strand and these T-tracts can be relatively weak or strong. When T-tracts prove insufficient to stop the polymerase, Sen1p plays a role by means of secondary structures in nascent RNAs, which act as auxiliary cis-acting elements. This backup method is termed the “fail-safe transcription termination pathway.” The RNA secondary structures are not absolutely required for RNAPIII termination, but can function as auxiliary elements that bypass weak or defective termination signals.
Once more, it is the power of the yeast model that has allowed investigation to such exquisite molecular detail. That cells preserve genomic stability and avoid pile-ups amid so much traffic along DNA remains truly remarkable–even when we know more of how it works.
Categories: Research Spotlight
Tags: replisome, RNA polymerase II, RNA polymerase III, Saccharomyces cerevisiae, transcription, transcription conflicts
A Redox Switch that Remakes a Guide Protein into an Antioxidant
August 05, 2022
Cells are efficient machines, honed by selection. Recent studies are showing us how cells are more efficient than we realized, with proteins discovered to have multiple functions that can be surprisingly different under changes in environment. A new paper in Molecular Cell describes Get3p as one such protein. Under non-stress conditions, Get3p acts as an ATP-dependent guide for post-translational insertion of tail-anchored proteins into membrane. Under stress, however, Get3p morphs into an antioxidant “guard” protein that prevents toxic protein aggregation by functioning as a chaperone. What are the mechanics of such a switch?
The finding came about in something of a backward way, where Ulrich et al. set out to find a eukaryotic chaperone protein specifically activated during oxidative stress. They looked for similarity to Hsp33, a bacterial protein that protects against oxidative damage by activation of a zinc-coordinating, four-cysteine motif. Their search led them to Get3p, which shares little overall homology but has the same conserved CXC and CXXC motifs.
Whereas the bacterial protein acts only in stress, yeast Get3p also has a non-stress role that differs from its role in stress response. Under non-stress conditions, it is the CXXC motif that plays the major role, where the two cysteines of the motif bind zinc, which aids the protein in dimerization. In the switch to the chaperone-active form, however, it is the nearby CXC motif that plays the critical role.
During oxidative stress, the switch to the chaperone form of the Get3p protein requires two things: (1) loss of bound ATP (with accompanying loss of ATPase activity, see below); and (2) oxidation of the free thiol groups (-SH) on residues C240 and C242 of the CXC motif. Once oxidized from thiol groups to sulfur groups, the two sulfurs of the CXC can form an intramolecular disulfide bond. Thus, in the presence of an ROS like H2O2, the new bond reconfigures the protein to become a non-ATP-requiring active chaperone. The CXC motif, then, acts as a “redox” switch.
The role of ATP with respect to the redox switch is illustrated in the above schematic, where the presence of ATP makes the two thiol groups inaccessible to oxidation. When ATP is lost (due to the oxidative stress that reduces cellular ATP levels), the -SH groups can be oxidized to -S groups that bind to one another and partially unfold the protein, making it chaperone active.
The authors further show how the CXC motif is dispensable for the normal protein-targeting function of Get3p but absolutely required for the chaperone function. Thus, Get3p has two cysteine motifs that act in fully different ways, where CXXC is required for normal guide function while CXC is required for protection from oxidative stress.
Whereas the toxicity of reactive oxygen species is well established, the elucidation of a redox switch-triggered stress response in yeast provides an important clue to how eukaryotes detoxify these oxidants. It would not be surprising to find other cysteine-motif proteins acting as antioxidants in related processes that save cells from damage. As usual, yeast is an excellent model for understanding these intricate relationships.
Categories: Research Spotlight
Tags: chaperones, oxidative stress, redox switch, Saccharomyces cerevisiae